"Fuzzbox is the closest thing to magic I have ever seen"
- Telecom IT Manager

Misspelled Fuzzy Lookup | Full Results Fuzzy Search Algorithm | Business Data Fuzzy Lookup | Genetic Sequence Fuzzy Search

Our Fuzzy Search Algorithm is also used to search GenBank so you can be sure it makes light work of fuzzy search on your business data :)
This demo demonstrates matching genetic sequences.
Try adding, removing and modifying letters of the genetic code below and FuzzBox will magically match the fields!

Percentage: Range can be in between .100 and .333.
The higher the percentage, the "tighter" the match. Between .170 and .245 is a good starting point

TIP! To get the best results be patient and find just the right percentage for your specific data!

Test Fields:

Column 1 Field 1: Column 2 Field 1:
Column 1 Field 2: Column 2 Field 2:
Column 1 Field 3: Column 2 Field 3:


Results:

Source Field Match Candidate
tcatggcggcggatggcggc
tcatggcggcagatggcggc
tcatggcggcagatggcggc
agatgccggcagatggcggc
agatgccggcagatggcggc